EST 44164 is a singleton


Sequence

>44164 (1 EST) Length=297 CCAACACTCGAATATCGTTCACCAAATAAAGTATATACTTTAGAACCTAAACAATACCTTGAACCATTAGAAAATATATT CTCAGCATTATGTATGCTTAACATTGTACCTATTGATTTAGAAAAAAATACCTTTGTTCTAGGTGACCCATTTATGAGAA AATATTTTACCGTTTATGATTACGATAATCACACCGTTGGATTTGCTTTAGCCAAAAATTTATAAAGCAAAAAAATTATA ATTAAAGCAAANTAAAGAAAAATAAAGCAAAATAANGAAAAATAAAGNAAAATATAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 44164: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44164462911T181250680c3czapPFDd2.1, Debopam Chakrabarti


Date: 2:24:20 on Thu 23 Nov 117.