EST 44165 is a singleton


Sequence

>44165 (1 EST) Length=250 ATAATAGTAAACATAAGAAAAATGATAAATTAAAAGAAAAACTACAGAAAAATGAAGNTACACATACACACAAAAAAAGC AGTGTTATATGTAAAGCCATTAAACATAAATATGGTTCCATAAATAGAACAAAAATTTGTAAAAAANTTAATTCGCTAGT TGCTACATGGTGTGATGATAGTAATATATATATATNTNGCATTNCTGGTGAAATTAAAAATTTAGAAGTTCGTCCATATA ATGNACAANT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44165: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44165462912T181260681c3czapPFDd2.1, Debopam Chakrabarti


Date: 14:41:31 on Tue 21 Nov 117.