EST 44169 is a singleton


Sequence

>44169 (1 EST) Length=342 CGAGTTTTTTTTTTTTTTTTTTGATCCTATCATTTTTCCATCAAGTTTCTTAAACCTACTGTTATTTCTTCTTCAAGTGC CTTAAAATACTTTTTGAAATATTCATCTGAATTTTTTGGGTTTTCAAATTTCATATGTGTAATTTTATTTATAGTTGGTC TTAATGTATTATATATAGATCCCCAACCAATTTTNCTTTCTCTTGAGTCATATTCTTGTAATGTTCTTAAGCATTGAGCA TAAAAGTGGCAAATAATTCTCATCATACCAACTGTTTTTTGTAATGGGCACATATAATCATAATCGCTAAATGCATTTTG TTGAAGAAAATCTTCTCTAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44169: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44169462916T181300690c3czapPFDd2.1, Debopam Chakrabarti


Date: 21:1:17 on Sun 19 Nov 117.