EST 44170 is a singleton


Sequence

>44170 (1 EST) Length=220 AGAAAAATAAATAACAACATTTTGGATTTTAACAAGTATGTGTATAAAGATAAAATGGAGGTGGGTGAAGAGGAGATAGA ACATGACGAAGAAAAAACAAAAGATGATGAAATAATAAATATGAAGAAGAAAAAAAAGAAAAAAAAAAAGAAAAAGTTAA GCCGTTTATTAGATAGTTCTAGTAGTGATGNTAATAATGAAAATGAAGAAATATCATCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44170: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44170462917T181310691c3czapPFDd2.1, Debopam Chakrabarti


Date: 15:0:50 on Sun 19 Nov 117.