EST 44171 is a singleton


Sequence

>44171 (1 EST) Length=299 AATGATTCATTTTATAATGCAATACTTATATGTATGAATGAAATAATAAAATATTTAAAAATATGTGATTTTAAAAATAA TTTAAAGAGTAAAATAAAAAGTGCGAAAAATGATAGTAATACCTCCTCAGGAACATCCATAACAGAAGTAGATGAAAAAN CCTATTTTGTTAAATCAGTCAAAAATGAAAAANATCTTTATAATAATAATATGAAAAATGTTATCACAACCAATAAAAGA AAAACATTAGAAAAANATAATATTTTAATAAATGNTATAATTCCTAATAATATAGTTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44171: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44171462918T181320692c3czapPFDd2.1, Debopam Chakrabarti


Date: 5:54:4 on Sun 19 Nov 117.