EST 44173 is a singleton


Sequence

>44173 (1 EST) Length=233 ATTTTATTGAAAAACAAAAAAAATAAGTAAATTTTAATTTTTATTTATAAGTAAATTATATTTTTTATAAAATATTATAT ATATATATTGNTAGTTTTCATATTATATATTATTCCTACAATTTATATTTTTCATTTATTTTATATTTCTTCTTATATAA AAATAAAACAAGTGGACAAATAATATATGAGCATATAATATATATATATATATATACCTGGTTTNATATAANA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44173: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44173462920T181340695c3czapPFDd2.1, Debopam Chakrabarti


Date: 11:40:13 on Fri 24 Nov 117.