EST 44176 is a singleton


Sequence

>44176 (1 EST) Length=342 CTCAATTTGAACCATTTTGGGATTTTTTTATGAATTTTAATTTACGTGTTGGATTTTTGATACAATTTATTTCTTACATA TTATTAGTTGGTGCAATAACAATAATTGGAAAAAACCCTTTAGGAATGTTAAACTTTTTGAGAGCATTACCAGGAAGTGT TGGTACTGCTCCAATGCCTTTAGTACTTTTTAGTATAGGTGGATTTTTAATGGGTACTCTTCTTATTATGTCCTNTTTAC AATTAACTGAGGATGATAGCAGGGACTGTATCATGGAGCTTGTCCCTTATATGTTTGATGGCCTCTTCGTACTATTTTGA TGACCCTTGGNTGGAAGAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 44176: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44176462923T181370699c3czapPFDd2.1, Debopam Chakrabarti


Date: 5:1:6 on Tue 21 Nov 117.