EST 44180 is a singleton


Sequence

>44180 (1 EST) Length=226 AGTACTGAGGGGGCTAAAAAAAATAAGGAAAGCAAACTGCATAGCGTAAAAAAAAATGAAGATGGGAATAAAAGCAAGGA AATAAATCAGAATAGTGACATGAACAAAAGTAATGAGNTTAATAAAAATAAAAGTTATGAAAAANTAAAAAGTAAGAGTG TAGATTTTAATAAAANTGTATTAAATACAGAAAAANTAAAANGTAAGAGTGTAGAATATAATACCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44180: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44180462927T181410707c3czapPFDd2.1, Debopam Chakrabarti


Date: 11:46:20 on Fri 24 Nov 117.