EST 44181 is a singleton


Sequence

>44181 (1 EST) Length=204 ATTACCTATAACTACCGTTCAAATAAAATCAGCTGTTTATATAAATAAATATTATTAAATTGATTTTATATTTGAATGAA AAAGAAACAAAAAAATTCGAACAAATTAAGGTTGGGTATGTAATTCTAATTCAAAATATATATTATTGTTTATATATATA TATGTNTTATATATNTTGGNTGGTTATATATATAANNGATTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 44181: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44181462928T181420708c3czapPFDd2.1, Debopam Chakrabarti


Date: 9:12:15 on Sat 18 Nov 117.