EST 44183 is a singleton


Sequence

>44183 (1 EST) Length=203 TTTAAATATATAGNGTATATTATAAGTATAATGATATAGATGCATCCAAAATGAATGTAACAAAAAGGACGTGCATATAA TGTGTAACATATATATATATATATGTATATATTTNATTTTTTTTATATGAATGTTTAATTTTTCATTATTATTTTTTTAT CTATATTTTATTATAAGATATAAAATAAATATATATATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44183: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44183462930T181440716c3czapPFDd2.1, Debopam Chakrabarti


Date: 0:22:46 on Thu 23 Nov 117.