EST 44184 is a singleton


Sequence

>44184 (1 EST) Length=350 TTCTATGTCTCAAGGTAAATCAGGAATGAAAAATTCCAAATCACTCTTCTTTAGTAGTGATATTGGTTTTTGCGTACATG AATTATCAAATAATGGTATCGTTACCAAATTCGTCAGTAGTAAAAAAGGAGAAGTTATATATACACACAAACTTAATATC AAGAAAAAAAAAACACTAGATAAAGTTAATGCCTTACANCACTTTGCTGCCTTACCCAATGTCGAATTAACAGATGTCCC ATCAAGTGGGCCCATGGGAAATAAAGATACCTTTGTTAGAGTTGTAGGNACCATTGGTATTCTTATAGGCTCCGTAATTG TTTTTATTGGTGCTTNCTCTTTTTTATCAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44184: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44184462931T181450717c3czapPFDd2.1, Debopam Chakrabarti


Date: 2:6:19 on Wed 22 Nov 117.