EST 44190 is a singleton


Sequence

>44190 (1 EST) Length=333 AAAACTAATATCCAATATGTTCTCTTCTTTCCAGTCATATTGTGTTGATAAATATAAAACCTATCATCTTATTGTATGTA ATATAATCGATTCGGACGATACCATATTATATGGTTTCGCACCTTTAAATAAGAGAGACTACTGGCCCCTCATATTTTCG AAAATAGCTTATACAAATGCCGAACAAATTAATTATGACACATTAACTGATGTAAATACTATAAAAATAAGAAAAACAGA TTTGAAATTTTTACTAGATGAAATTAAGGATGTATTCAGGGGAATTATTAAACATGATTATAAAAAGGGACTACAAGCCA ACCTAAAAGGGCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44190: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44190462937T181510728c3czapPFDd2.1, Debopam Chakrabarti


Date: 12:3:46 on Fri 24 Nov 117.