EST 44191 is a singleton


Sequence

>44191 (1 EST) Length=350 ATAATTAAAGGTTTCTCATTATTTTTCTTTTTTATTATTTCTTTTAATATTTCAATTTGTAAAAAGCTAAATCGTCCATT TTCTACATTCAAAAGAAGAGAAAGCTAATGAGTTCGAATCAAGTGATAAAAATGAAAAAGAAGAAGATATTTTGAAAGAC ACACATTTAAAAGGAAAAAAGAATTCACATATATTTATACCAAATAAAACTATAAAAATAAAAAAGGCAAGTCCATTTTT TTCAGAACCTAAGCATTTCACAAGAAGAGGAAAAGGNTATTTCAAATTATGCAAATGGTGGTATGTCTAATAATAAAAAT GGTACAAGTCATTCAGGAAAAAACGGNTCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44191: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44191462938T181520729c3czapPFDd2.1, Debopam Chakrabarti


Date: 9:58:9 on Wed 22 Nov 117.