EST 44192 is a singleton


Sequence

>44192 (1 EST) Length=221 ATAATATTTTTTTACANAATTGTAATTAGATATATATAAGAAAATGCTGAAATAAAAAAAGAAAAAAGTAGAACAAAATT TAATATATTATAATAATAACTTTTCTTACATTCCAGCAAAAAAAGAAGATATNATATATTATATATTATATATATATATA TATATATATATATATATATATACACATATANGCTTANCCTNTTCTCATAATATTTAACATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44192: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44192462939T181530732c3czapPFDd2.1, Debopam Chakrabarti


Date: 7:37:35 on Sat 18 Nov 117.