EST 44195 is a singleton


Sequence

>44195 (1 EST) Length=264 AAAAAGNAGATGAACAAGTAGCTGAAGAATTAGTTNAAAAAGTAGATGAACAAGTAGTTGAAGAAGTTGCTGATGAATTA GTTGAAAAAGTAGTTGAAGAAGAAGGTGAAAAAGTACCTGAAGAAGTAGTTGAAGAAGTAGCTGAAGAAGTAGCTGAAGA AGTAGTTGAAGAAGGTGAAAAAGTACCTNAAGANGTAGCTGAAGAAGTAGCTGAAGAAGTAGCTGAAGAAGTAGCTGNAG ANTTAGTTGAAAAAGTAGATGAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 44195: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44195462942T181560737c3czapPFDd2.1, Debopam Chakrabarti


Date: 14:40:0 on Tue 21 Nov 117.