EST 44197 is a singleton


Sequence

>44197 (1 EST) Length=265 CAAAAATGTGATTCATGTTATAATTTGAATGTATATATAAAATATATAATATTATATGATATATAATATTTATTTTTTTG CACACATATTTTACATTTTAATAAAATTAAAGAAATGGAATGAAAAAAAAAAAAAAANTAAATAAANTTAAAAATAATGG TTTTCCTGTTTGGATATATTATATGTAATTNCCACAAANTCCTNCAAATTATGTTAAATAAAGGTCCGTTTAGGTTTTTN GGATTTTTTTTTTTTTTTTAATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44197: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44197462944T181580742c3czapPFDd2.1, Debopam Chakrabarti


Date: 14:54:2 on Wed 22 Nov 117.