EST 44198 is a singleton


Sequence

>44198 (1 EST) Length=251 CTCGTGCGCTGAGTNNTTTTTTTTTTTTTTTATATATTTTTATTTTTTTGCTTGTACATTATTATCCTTCTTTTTATCAT CTATAACCATATATTCACATTATCTAAGTAATTATGGGATAGTAATTTTTTAATGTCCTTAATCCAAGATTATCATCAAA CCTAGAATGGTTCTATACAAAAATTTTATATACTTATGTTGTATTTAATATCATATAAAGAAAATTCTAAGGGCTTACTA TTTAAGGAGGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44198: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44198462945T181590744c3czapPFDd2.1, Debopam Chakrabarti


Date: 12:56:32 on Sat 18 Nov 117.