EST 44200 is a singleton


Sequence

>44200 (1 EST) Length=256 TTAAGATATGATCCTAATAAAGATTTATTTAATTCTTTATTACATTTAAGAAAAGCTATAATATCAGCTGATAATGTATT ACCAATATGTTCCTTGGAAAAAATACATTTACATACATGTCTTTCAGAATATACATATATGTGTTCTAATCTATACAAAT TATATCATAAGGGTATGGGAATATCTCCAGAATATATTATAGATCCCCNTGTTCTCTGCTATATGGAATNCTTGTGTNAT AACAGGTTATGATCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44200: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44200462947T181610747c3czapPFDd2.1, Debopam Chakrabarti


Date: 17:57:7 on Tue 21 Nov 117.