EST 44203 is a singleton


Sequence

>44203 (1 EST) Length=192 TATATATATATATCCTTCATATATATTATGTATTCTCTTNTTTTATTATTATGTATATATAATTAAAAAATATATTATAT ATATATTTNAGTAATGCTAAAAAAAAAAATATAAGGAAATAATAATGTAAAATAATATTATTAATTTATATGTGTTATGA CAAGACATATATATACACCCATATANTATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44203: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44203462950T181640756c3czapPFDd2.1, Debopam Chakrabarti


Date: 3:53:56 on Sun 19 Nov 117.