EST 44205 is a singleton


Sequence

>44205 (1 EST) Length=247 AAAAAATAAAAAAAGATATAGAAAATAAAGCTGTTAAATTAAATCAAGCATTTAAATATCCATCCATATTTTATGAACAT TTTGAATTCTTATCATCTGATGAATATAATTATGTAAAAAATAATTATATATACAGTGCTATACTTATATATAACCCTAA TATTTCTAATAAACATAATATTGAAAAAAAAAAAACCCANGGNTCAAAANTTAAAATTTGTCATAATGGTGTGATAGACT CAAATCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44205: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44205462952T181660759c3czapPFDd2.1, Debopam Chakrabarti


Date: 10:37:0 on Tue 21 Nov 117.