EST 44208 is a singleton


Sequence

>44208 (1 EST) Length=250 TACCAAATGACAAAAGTGCAAATTCAAAACTAGCTACAAGATTAATGAAAAAATTTAAAGCTGAAATCAGAGATTTCTTC AAAGAAATGCGTATACAATATGCTAAATTAATAAACATACGTTACAGATCTCACTTAAAGAAAAACTACTTTGCCTTCAA GAGATTAGATTAAGAATATAAACTTGAAAAATATATATAATGTAAAAATATACTAAATATATTAATATAATATATATATG TGTGTGTGTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44208: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44208462955T181690767c3czapPFDd2.1, Debopam Chakrabarti


Date: 14:27:27 on Tue 21 Nov 117.