EST 44212 is a singleton


Sequence

>44212 (1 EST) Length=224 AGACAAAGAAGATGACAAAGAAGATGAAAAAGAAAAAGACAAAGAAGATGACAAAGAAAAATACAAAGAAGATGACAAAG AAGATGACAAAGAAGATGACAAAGAAAAAGACAAAGAAGATAACAAAGAAAAAGACAAAGAAGATAACAAAGAAAAAGAC AAAGAAGATGACAAAGAAAAAGACAAAGAAGATGACAAAGAAAAAGACAAAGAAGATAACAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44212: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44212462959T181730775c3czapPFDd2.1, Debopam Chakrabarti


Date: 5:12:43 on Sat 18 Nov 117.