EST 44217 is a singleton


Sequence

>44217 (1 EST) Length=264 AAAAAAAATAGGTGATAAGCATGATGTTGTTTTATCCTTTAAGGATAGAGAAGAAATTCCTGTTGTTTCCAGAATACCAG CTCCATGGTTAAGTTCTTAATTCAAAAAAATAAAATAAACATAAATAAACATAAATAAACAAAAATAAAATAAACAATAT AAAACACTGAAGAGACACATACAAATATATATGTAATATTATATATATTTGTGTGGNGTGCTTATAAATTAATAGCTATT TTNTCCATNTAATAANNAATATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44217: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44217462964T181780784c3czapPFDd2.1, Debopam Chakrabarti


Date: 10:47:38 on Tue 16 Jan 118.