EST 44218 is a singleton


Sequence

>44218 (1 EST) Length=198 ATTTATATAAAACACTATCAGGTTTGTGTATATTATATCTTTATAGGTAAATTTTTTTTTTTTTTTTTTTAAATAAAAAA GGTATAATGGAATGGTAACATTTATGAAGCTATTTTATTTTACCCTTTAAAGTATATATAATATAGGNGACATATAAGAG ACCTCATTGGTACCATAGATATATATGTATATGGGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 44218: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44218462965T181790785c3czapPFDd2.1, Debopam Chakrabarti


Date: 8:30:2 on Wed 22 Nov 117.