EST 44219 is a singleton


Sequence

>44219 (1 EST) Length=153 TATAGTTGTTAATTTTTTTTAAAATTTTATACCTTCTAGAAATAAAAAATTTAGCAAAGGTGTACAAAAGATAATTAGAG TATACCCATTTGTTACATCGATATAGAATATATTGTATTTTNATTTATTTATTTATTTATNTNNATTTTATNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44219: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44219462966T181800786c3czapPFDd2.1, Debopam Chakrabarti


Date: 1:23:40 on Mon 20 Nov 117.