EST 44221 is a singleton


Sequence

>44221 (1 EST) Length=297 AAATGTTATACAAAAAAAAAAAGAAAATTATATCAAATGGAAGAACATGTTTGATGATTTCNCTTTAAAATATCCACAAG TATCACAAGAAATTATAAGACGATTTCAAAATGATTTACCAAATAATTGGAAAGATGCATTACCAAAATATACACCAAAA GATGCACCAGGTGCTACTAGAAACCTATCTGGAATTGTCCTAAATTCAATAAATAAAATATTTCCAGAGTTAATAGGAGG TAGTGCAGATTTATCCGANTCAAATTGTACATCATTAAAAGGNGGAAATGGTATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44221: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44221462968T181820789c3czapPFDd2.1, Debopam Chakrabarti


Date: 10:46:25 on Sat 18 Nov 117.