EST 44232 is a singleton


Sequence

>44232 (1 EST) Length=350 AGAACATCATCTTAGATTATACGAATTTGAGAATGACTTATTTAAATTTCATCCAAATATTGATTATTTAACTTTAGCTG ATGGATATAAATTACAAAAAAATCATATATATGAATTATCCCATGTAAACTTTTGCTTATTAAATCCTAAAACATTAGAA GAATTTTTAAAAAAAAAAGAAATCAAGGATCTTATGGGTGGTGATGATCTTATAAAATATAAAGAAAATTTTGATAACTT TATGAGTATATCTATAACATGCCATATTGAATCTTTAATATATGATGATATTGAAGCATCTCAAGGTATTGCTGCTGTAT TAAAAATTTGCTAAAGGTAATTNCATGTAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44232: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44232462979T181930800c3czapPFDd2.1, Debopam Chakrabarti


Date: 12:11:53 on Mon 20 Nov 117.