EST 44237 is a singleton


Sequence

>44237 (1 EST) Length=333 AGAAGATCTAACCATAACTATGGTATCTAATGGACAATATGTAGGATTGAAAACATCCTTATTAGAAGATCACGAAAAAG CTTTAGATTTATTAATTATTATTATTGAAGTATTAAAAGAAAATTATAAGGATTATATTCAAGCAACAGCTACAGCTGTG TTGCCAATGTTAAATTATGAATTGTCAGATGAAATTAAACAAAAGGCATTAACAGCTGTTAGTGAATTAATTGNATCAGC AAGANTATTATCTGAAAAACCGGGATAATGNTAAATCCATGTTACTAGCCATATTAACAGCAGCAGCAGAAAAAAGTATT AAAAAGTCTATTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44237: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44237462984T181980808c3czapPFDd2.1, Debopam Chakrabarti


Date: 10:34:16 on Tue 21 Nov 117.