EST 44251 is a singleton


Sequence

>44251 (1 EST) Length=292 TATTTCGTAAGAAATATTAGGTTGAACTCTCTCTTTAAATTGATTTCATAATAATAAGTGTGTACTATAGNTTATTTTTG TATTACACATTTATTATTATGAAATCAATTTCTGAAATGCTGTATGGATATATAAAATCCTTATAAGTGTGTTACGAGCC TTTTGAGGTGGAGGTTTGTAATTAATATATTTNGATCAAAATTCTGAAACGATCAAAGTATCCTCATTATAATTCTTAGG AATATATTTGCAGGTTTACCTCTTCATTAATTACTTTATAATATAATATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44251: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44251462998T182120825c3czapPFDd2.1, Debopam Chakrabarti


Date: 15:9:6 on Wed 22 Nov 117.