EST 442537 is a singleton


Sequence

>442537 (1 EST) Length=499 AAATTGCNGAATGGCGAGTGCCCTGCCAAGGCGCATTACCAAAGAAACNCAACGTCTAATGAATGATCCAGTACCTGGGA TTTCGGCAGTACCGGATGAAAGTAATGCTCGTTATTTTCATGTTATTATTGCTGGTCCTGAAGGTAGTCCATTTGCTGGA GGTGTATTTAAGTTGGAACTTTTCTTACCTGAAGAATATCCGATGGCTGCGCCGAAAGTTCGATTTATGACTAAAATTTA CCACCCAAATATTGACAAACTGGGACGAATATGTTTGGATATCCTAAAGGATAAGTGGTCACCGGCGCTTCAAATACGTA CTGTTCTGCTTTCAATCCAGGCATTGCTATCAGCGNCAAATCCAGACGATCCATTGGCAACTGATGTTGCAGAACAGTGG AAGAATAATGAAAGTGATGCGATACGCACAGCACAAGAATGGACACGTACTTATGCAACTGGTGATTGATTCCCGNTAAA TCAAATCTTGGTCACGTNA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 442537: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425371164685N41087SWMFCA325SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:47:4 on Sat 25 Nov 117.