EST 442540 is a singleton


Sequence

>442540 (1 EST) Length=484 TTGCTAATGTATTAAAGCAGAGGATTATTAATACTGTNAATCATAAGACTATTGGTACTTATTATATTGTNTNAGGTTAC TGAGCAGGATTAGGTGGATCTTTATCATCTATAATCATTCGGGGGGACCTCTCTAGGACCGGTGGTTATTTGTGGGTCGG TAGACACCAANTATATAATTCTGTCTCAACTATGCATGGGGTTNCAATGATTCCTCTCATAGCGANGCCTATGCTGATCG GCGGGGCNGGTAATTGAATATCACCTGTCATACTCGGCNCNCCAGAGATGGCTCCCCTCGGATAAATGCTTTATCTGGCN GGCNTACTGCCGTGGCTTCGTTGATGNCTATCAGCCTNCTCCCATTGGCGGCCGCACAGGAAGTAGNTGAACTTCTCNTC CTCCTCTANGAGNAGAGGGCAGCAGACGTTTCTTTAGATGTTATANGGCNGGCGATGCATCTGTAGGGATCGCNTCTCGG GNCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 442540: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425401164688N41090SWMFCA319SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:56:23 on Mon 20 Nov 117.