EST 442548 is a singleton


Sequence

>442548 (1 EST) Length=542 AGCTAGGCAAAGACTCAGAATCCTTCAGGTTGATATATACATTATTGGGCTTTGGCCTTCCTACTGAACAACTGCATACC AGTTCTTTGNTTCCCTACCTCTCAAGTAGGTAATCATAGATCACTGGGCGGCTCTCCCCCTCTGTTATCTGTCCTACCTT CTGCTAAACAACATTCTTCTCTTAAGTNGTGTGAGATGACTCTCCATAGCACAGCAATGAGATCANGCAGCTTAATCACG CTGACACAAATGACAGAATTTTTGGGCGCGCCTGAATATCATGGCGCCGTATATAAGTATCAAATTTCTCCATCCAGGCG CAGCAAAGGGATNTTCCAGTNGCTCCCTTTTCTTGGNTTATCCACCCGCATGGAATTGCTGATAGTTGGCCGCTCTTTTC TCAGGTGGGGAGGCCANCACATTGCCNTCAAAAAAGCTNTCTACTCACCCCATAGCAANNTTCAATTTTGGAGCGACATC ATCTTACAGNCTTGGTANCGTCGTCAATGAGGGGGATNTCNTTCTTTATCTCNACTACAAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 442548: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425481164696N41098SWMFCA269SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 2:32:36 on Fri 24 Nov 117.