EST 442559 is a singleton


Sequence

>442559 (1 EST) Length=518 TCCCCAACTANAGAATCTGATGGTCTCCATCTGTCGAACCTCGCATATGTTATCGATGATTCAGCCACCAAACTAAATAA TGAATCANGTCCAAATGGAATAGCACAATGCTTACACTCTACACTTATTACATCTATCAGGTGGNTCAATACTACACATC TTCCACACGCGTGGCAGANCACGACTCACCACGTTTCTCGTCTCAGGACGAGATTCGACAAAGCAACAGCANCTTTACTG AGGNGGGTGCAGCTTNCANNGGCAGGTATTATTGAANTGTGTGACGGACAAGAACTATGTCTGGAGGATAGTACTGGTCC TGAAAACAAATTTACTGGGTTGATGCAATGGAATAGCAGTGNCTNGCCGCNGCAGTCACAGGTGGCAGGCAGAACTCATT CTCCCTACCATGNTTAATTACAGGGAGGGACAAAGNGCAGACTCANTCTNCTGGGTCCCCCACCATNGAAANCACTGGGG GCGGGGGGGAAAACTCACCATCGNGATTCAGGGGTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 442559: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425591164707N41109SWMFCA281SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:47:12 on Sat 18 Nov 117.