EST 44256 is a singleton


Sequence

>44256 (1 EST) Length=163 GGCACGAGCGAGTTTTTTTTTTTTTTTTTTGTTTTTTAATAATTCATTATTATTAAAAATTATATTATTTTTAAAAGNAA AAAGNTTTTTAAAATGAAAACATATATATATAGAAAAAATTACTTAATATTTGTATATATATATATATATATATATATAT ATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST, Processing,


Cluster Information for 44256: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44256463003T182170831c3czapPFDd2.1, Debopam Chakrabarti


Date: 0:30:18 on Thu 23 Nov 117.