EST 442565 is a singleton


Sequence

>442565 (1 EST) Length=537 CTAAGGAAACATACNTAAGAAATGATAATTGTAATTTAAAGGAATATATTTCGGTGAATTCAACAGAGCGGTATAATGTT AAATNGCCGAAAGTGACACTCTCCTCTGTCGGATATATACTATCACTCANCATTACTGTCATCATCATATTCGGTTGTGG ACGCACAATCTCGACTAAACTTNCAGGCGGTGATGCAANTACGCAACGTTCTAATAATTGCAGTTTAGTTATATGCGAAA AGAAGCTTTCTTCAAGAAAAGTTCCANTANACCTGGTTGGNACCTTGGCGACCGATATGGAAANCAGCACAAAAGCTGGC TTACATCAGCAGTATTGGGCCGGNCTGGAAGTGACGAATTAGAAAACCGCCAATTACTGGATGAAATACACAGTCACTCC ATNCAGCAACGGAATNGATACAGGAATTANTTNGGTAACCTACCCGATGATGACCGGCCACACTTATTCAAGTATGTGCG CCGGACCCTCATGCAAGAAATAANCACCGNCCGGTTCGGAGCAGGTCACGATGACCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 442565: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4425651164713N41115SWMFCA289SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 14:21:17 on Sat 18 Nov 117.