EST 44258 is a singleton


Sequence

>44258 (1 EST) Length=170 TGAAGACGAAGATGATGATGATGATGAAGATGATGATGAAGATGATGATGAAGAGTATCATGTGAATAAAGATAATAGAG AGAAGAAAAATAAGAACAGTGATAATATATCATTATTAGGAAAGAGGNAAATATCACAAGATTCTATAAAAGACGAATTA TCCAGAAATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 44258: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44258463005T182190836c3czapPFDd2.1, Debopam Chakrabarti


Date: 9:57:47 on Fri 24 Nov 117.