EST 44260 is a singleton


Sequence

>44260 (1 EST) Length=249 AAAAAATCTTCTATTAAAAAAACCAACACAATTATTTATCCAGGGGCAATGATGATCCATATTTAATACACATCTATTAC AAGCAGAACAATGATGGGTTCTGTCAGGTTTCCATACGTTACAAATTTTACAATACCTTCTTCTTTTCACATCATCACCT ACATAAAAACCCCAATTACGTGGAACCTTTCCTGGGTCGGTTGAAGCACACTGGAAATAAAAAATATAAACCATAGAACA TAGAATATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44260: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44260463007T182210838c3czapPFDd2.1, Debopam Chakrabarti


Date: 12:56:42 on Sat 18 Nov 117.