EST 44263 is a singleton


Sequence

>44263 (1 EST) Length=242 CTCCACCGCGGTGGCGGCCGCTCTAGAACTAGTGGATCCCCCGGGCTGCAGGAATTCGGCACGAGGAAGAAAATAATATG TTAGATTAATTATATATATAACATTTTAATACGTTATATAAATATTGTTGTTCGTAGTATATTTTTTGAATATATTATCA TATATTTNTTTTTTTTTTTTTTATGTCAACATTAAATATTTATGTAAGTATTTTGAATTTAATATATATATATNNTATAT CC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 44263: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44263463010T182240849c3czapPFDd2.1, Debopam Chakrabarti


Date: 14:53:26 on Sun 19 Nov 117.