EST 442681 is a singleton


Sequence

>442681 (1 EST) Length=255 TCACAACAAAAATAAATTGACAGTTATTGTTAAGTATTTTATGAAAACAGTTTCACTGTTTTNGAATATGCGCCATTTTA CATGCACCATTGTTGTGTCCTCAGTTGAACATTTGCCTTTTTTATTGGGGAATACTTTGTTTGGTGTATTCGCACTGTCT TTAAGGCCATTTTTCTTATTACTGACGTTTGGTTCGTGTGTATGTATCCTTATATTGTGTTTTTAGAAATCATTATGAAG TCTTCATTATTTCTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 442681: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4426811164829N41231SW3ICA1067SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 3:48:50 on Sun 19 Nov 117.