EST 442683 is a singleton


Sequence

>442683 (1 EST) Length=335 CTAAAAAGCAATATTATATCCAAAGCATATGATAAGTAATGTGTTATTTAAATGCTTTTTAGAAGCATTTAAATTTCAAC AATTGTATCAATATTTCTGATATGATCAATGTNCCGAACAATATTTGCAAGTCTTAGGACATNCAGTTGCCATTAGTGAG GCATAACGTGGATCTCGACATAGCATTGCATATCTTCGACAANCCGAATGACCATTTGAACCTTTTAGATCAACACAGGT ACCATTTGTAAGTTTACCTACAAAAATATGGCTTTNTTTTTTCCTCCATCCATCCATAANTNTCTGAAATGGNGATTGAT TTANTTTNTTTGGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 442683: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4426831164831N41233SW3ICA1069SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 4:25:22 on Mon 20 Nov 117.