EST 442686 is a singleton


Sequence

>442686 (1 EST) Length=442 NAAAAAGCNGTAATAATTCNCAATGCCGGATTATATCNAACNAGTTACGGTTACCGGTGACGTNTCAGCAGTTACCGATA AAGATGATTTATTGCAAGAATGGTGTGCTGAAGTTGCAAAAGAAGTTTGGGAGCAAAAACCGGAATTTGCAATTATACAT ATACAAGGATTGCGGAATGCCGAAAATCCTGACATTCTTTCGAATAGAATTTTAAAAAGCATACTATACGATGCGGCTGA AGTACAAAATTTATTTAAAACAAGCCGCTCATATTTTGACACTCGTGAAACGGGTCTTGGATCAATTTATTTATTTCGTG AACATGATGAAGTAGAGTCGNNTGATCGCTACAGTAATAGCGGNTATAAAAGTCTTCGNCCAGGACATCAAATATGAAAN NGGTGCACGAGAATGTGATGGTTNCATTTCAAATATATTTAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 442686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4426861164834N41236SW3ICA1070SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 8:54:26 on Tue 21 Nov 117.