EST 442690 is a singleton


Sequence

>442690 (1 EST) Length=154 TTTAGCTCAAATAAATATTTTCCTTTTCAGTAAATTGCTAACATCACCATAACTTATCTCAAAGTTATCAACAAATTTCT CCTAATTAACTTGAATGAAGCGAGAAGCCAGTTTATTCTATGTAAAACTCTTAGTTGTAATNAACCTTNNCATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 442690: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4426901164838N41240SW3ICA645SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 11:57:58 on Wed 22 Nov 117.