EST 442702 is a singleton


Sequence

>442702 (1 EST) Length=155 ACGACGGTAGAAGTGCTTTCCATGGAGTCGTGTTGCTTGATAGTGCAGCACAAAGTGGGAGGTAAACTCCTTCTAAAGCT AAATATCACCACGAGACCGATAGNGAACAAGTGTTCTCGCCGAACAGTCCCTTCTTTACCCCTCATNNCCCCCCG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST, Processing,


Cluster Information for 442702: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4427021164850N41252SW3ICA665SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 14:46:41 on Sun 19 Nov 117.