EST 44271 is a singleton


Sequence

>44271 (1 EST) Length=164 GAATAATCAAAAGAACTCAGGACAAAATATGAATAAGACTATGACAAATAATAATTCTTTGCGATTACAAAAAAAAAGNC AATCTTGTAGTGCAACAACGAATTATTGTAATTGCATTTGAAGAATAAGAAGAAGGATCCCCTTCAAAAAAAAAAAAANA AAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44271: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44271463018T182320866c3czapPFDd2.1, Debopam Chakrabarti


Date: 12:44:34 on Tue 21 Nov 117.