EST 442718 is a singleton


Sequence

>442718 (1 EST) Length=131 GCAATTCACCTGCAGTACGATCGGGCGGTTATTTTCAAGAACGACACTTTCTTCATCAACGTCGATGGAAAGAACTGNCA GCTGGGGGGGGCTCCCTGCAAGCTCGGNGATGTCCATNACATTGANACCCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 442718: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4427181164866N41268SW3ICA674SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 3:50:53 on Sun 19 Nov 117.