EST 442743 is a singleton


Sequence

>442743 (1 EST) Length=596 GCTGAGNATCGGNGAGGAGGTTTGANAGAGTGAGAAGAGAGNGACGAAGGAGCGGTTGANGCGNAGTCNTAATAGTATGA AGAAGGAGCATCGTTGTTGCATATTTTATGTCAAGAAAGGATTACGTTGGCAGCACTGAAATATTGGTGGAAGTGATTCA CCGTTCACACATCACTCATTGACGGTTCTTTAAAGGTCATTCATCAAAATTCCATCAGATAGATCCGGCAATTGTTGCAT CAAATCGGATTTGATCCCCACACGACAATGGCTATAGAAATGGTGAAATTTATGTCCAGCTGGTAACATCAGCTGAAACA AATTTAGCAATAGGACAAGATGCCGGGAAGTTATTGGCAAATATGGTCTATCGATATTCACGTGTTGATTATGTTCCCTG ATCGACGAAGTTATCAAATGCGCCAGTGAAGTGACGAGTATGGTATCATCGTATCTGCATTCACATNCAGTCACATCGAC GATTTTCATAGAACTCTCTGCTCAATAATCTCTTCAAGTNNNTCAAATGCAAAGAGGTTGGTCAGGGAATGNTGTGTGNT GGGAATGGNATGATNTGAAAATCACAAGGGGNTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 442743: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4427431164891N41293SW3ICA1019SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 7:28:35 on Sat 18 Nov 117.