EST 44286 is a singleton


Sequence

>44286 (1 EST) Length=280 AGATAATGAAGAATATAAATTTGAAGAAGAAAATAAAGAAGACCTTCTAGATGTCCAACAAGATGAAGAATTACCAAGTG AAGGAAAACAAAAAGTAAAAGGAAAATCATTCGATAATGAACATTTGANTGAAATACAAAATGTTAGCGACGTACATGCA TTTATACAAAAAGATATGAAATATTTAGATGATCTCATAGCTGNAGAGCACACTATTAAAGATGCCGTCAAANAAAGTGC TTATANAGGCAATANGCNCTTAGGCCATANTTCCCAACTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44286: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44286463033T182470910c3czapPFDd2.1, Debopam Chakrabarti


Date: 5:3:4 on Sat 18 Nov 117.