EST 44287 is a singleton


Sequence

>44287 (1 EST) Length=184 TATTTTAAAAGATAATCAAAAAATAAGATATATAAATAAAGAAAATCAAGCTACTAATAATAATATTAATAATCAAGNCA ATTCTAATGATGTTTTAAAAAAGGATAAAATACAAATTGAAGAGATTAAAAAAGAAACGAACCAAATTAATAAAGATATA GATCATATAGAAATGAATATCATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 44287: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44287463034T182480420c3cbsPfHB3.1, Debopam Chakrabarti


Date: 15:20:15 on Thu 23 Nov 117.