EST 44289 is a singleton


Sequence

>44289 (1 EST) Length=210 AACTNGTCTTGAGTTTTTTTTTTTTTTTTTTGGAATATATTAAAGGGATGTTTCTTTTATATATTATATATATATAANAN GTGTTTNTATAACTATATTTTTTTCATTTTTTTTTTATTTTATTTTATTTTTTTTTTGTAAGAATAATTTCTTTAATCAT TACAATTGAATATTTATATGAAGAAATTTATTTATTTATATNTNNATTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 44289: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44289463036T182500461c3cbsPfHB3.1, Debopam Chakrabarti


Date: 22:33:2 on Thu 23 Nov 117.