EST 44290 is a singleton


Sequence

>44290 (1 EST) Length=270 AAGAAAGGTGAAAAAAAAAAACATATATATAATAATCCTATCAAATATAAAAAGACATATAATAATAAAACATATAATAT AATTAATAAGTCAATAAGNAAAATTGAATATATAAAAGNNTATTTGATAGTATCTAATTTAAGACATCCAAATATCTTAC AATGTATAGGAAATATATTCGTTGATGACANGGAGGATTGTGGCATTGTTTTTGAATATATAAAAGGGAAAACTTTATAT GATTTTNTATATAANNCGGGCTATAATAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 44290: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
44290463037T182510468c3cbsPfHB3.1, Debopam Chakrabarti


Date: 13:51:48 on Mon 20 Nov 117.